SCTIMST researchers develop cost-effective, real-time LAMP assay for early TB diagnosis with high sensitivity and specificity ...

A Chinese research team has successfully developed a triplex real-time quantitative fluorescence PCR method capable of ...

This important study shows that the Nora virus, a natural Drosophila pathogen that also persistently infects many laboratory fly stocks, infects intestinal stem cells (ISCs), leading to a shorter life ...

Reverse transcription–polymerase chain reaction (RT-PCR). RNA was subjected to reverse transcription and PCR using Fcα/μR-specific primers (5′–AGTGTTACCACGAGTGAAGG–3′ and 5 ...

"We're now detecting things almost in real time." His lab looks like a typical ... can simultaneously test for multiple diseases. "My primer can pick up dengue, plus chikungunya, plus Zika ...

ABL1 digital PCR can reliably quantify stable deep molecular remission of chronic myeloid leukemia (CML), which will help to determine for which patients chronic drug treatment could potentially be ...

PCR-Machines are based on Polymerase Chain Reaction (PCR) and produce copies of genes exponentially. The PCR cycling reactions are carried out in an automated thermocycler, which is capable of ...

A new discovery has reshaped our understanding of PCR chip technology: water vapor, not air expansion, is the primary culprit behind bubble formation ...

PCR-based techniques are methods that rely on the polymerase chain reaction (PCR) to amplify stretches of DNA by creating many identical or near-identical copies. For example, PCR amplification ...

WFS1 and CISD2 regulate IP3R activity through their interaction. In Wolfram syndrome, their dysfunction reduces cytosolic ...